| SKU: | MB1001 |
|---|---|
| Application: | PCR |
| Description: | PCR Master Mix provides an efficient, accurate, and convenient way to amplify DNA from any template. This pre-mixed formulation saves time and reduces contamination due to a reduced number of pipetting steps required for PCR set up. |
- Technical
Specs - Kit
Components - Gene
Information - Application
Data & Images - Reviews
Publications - Customer
Q&As
Introduction
PCR Master Mix provides an efficient, accurate, and convenient way to amplify DNA from any template. This pre-mixed formulation saves time and reduces contamination due to a reduced number of pipetting steps required for PCR set up.
PCR Master Mixis a 2X concentrated ready-to-use solution of Taq DNA polymerase, dNTPs, MgCl2, PCR stabilizers and reaction buffers at optimal concentrations required for routine PCR DNA amplification. To set up a PCR reaction, DNA template, primers and water need to be added to the Master Mix at proportions as given in the protocol below. The PCR Master Mix is optimized to amplify targets up to 5 kb in length from lambda DNA. Additionally included gel loading reagent and dye allow PCR products to be loaded onto agarose gel directly.
The Master Mix provides a final concentration of 1.5 mM MgCl2 in the reaction mix. If a higher Mg2+ concentration is desired, please adjust Mg2+ concentration accordingly using 25 mM Mg2+ solution provided with the Master Mix in the kit.
Taq DNA Polymerase is a thermostable DNA polymerase isolated from a strain of Thermus Aquaticus, possessing a 5´→ 3´ polymerase activity and a very low 5´→ 3´ exonuclease activity. It has a half life of 3 hours at 95o C, and can replicate a 1000 base pair strand of DNA in less than 10 seconds at 72 °C. Taq has a middle level of fidelity with an error frequency of 1.10-5(around 1 mutation in 100,000 base pairs) during DNA synthesis. It is designed for use in primer extension reaction as well as sequencing. DNA sequencing with Taq DNA Polymerase produces uniform bands intensities and low background.
Overview
| Product Name | PCR Master Mix (dNTP mixture, 100/500 preps) |
|---|---|
| SKU/Catalog Number | MB1001 |
| Description | PCR Master Mix provides an efficient, accurate, and convenient way to amplify DNA from any template. This pre-mixed formulation saves time and reduces contamination due to a reduced number of pipetting steps required for PCR set up. |
| Cite This Product | PCR Master Mix (dNTP mixture, 100/500 preps) (Boster Biological Technology, Pleasanton CA, USA, Catalog # MB1001) |
| Application | PCR *Our Boster Guarantee covers the use of this product in the above tested applications. |
| Pack Size | 100 Reactions, 500 Reactions |
Properties
PCR Master Mix (dNTP mixture, 100/500 preps) Images
Click the images to enlarge.
List of Components
Store all components at -20°C. Enough reagents are supplied for a total of 5X 20 PCR reactions.
| MA1001 (5X20 PCR Reactions) | |
|---|---|
| PCR EZ MASTER MIX a) b) | 5 X 500µl |
| Control DNA Template(10ng/ml) c) | 1X 100ml |
| 5`-Control Primer I (10µM) d) | 1X 20ml |
| 3`-Control Primer II(10µM) d) | 1X 20ml |
| PCR Grade Water | 2 x 2ml |
Application Details
Each vial of PCR EZ MASTER MIX (500µl) is sufficient enough for 20 PCR reactions. Each PCR reaction requires 25ul from PCR EZ MASTER MIX.
- a) 1 Unit of Taq Polymerase is used for each PCR Reaction.
- b) Final concentration in each PCR reaction: 10mM KCl, 10mM (NH4)2SO4, 20mM Tris HCl (pH 8.75), 0.1% Triton X-100, 0.1mg/ml BSA, 2mM MgCl2 and 200uM dNTPs.
- c) The template is lamda DNA provided at 10ng/ul.
- d) Control Primer Mix (10 µM each)
- 5’ primer 5’–ATA ACGCGTCGCCGGAAGCC –3’
- 3’ primer 5’–GACCGGGGAGGATACGTTTCAC–3
Note:
For qPCR, fluorescent reporter probes also need to be added to the final mixture.
For DNA labeling, modified dNTPs (e.g., biotin-, digoxigenin-, fluorescently-labeled nucleotides) should be used.
Additional materials required
The following reagents are not supplied:
- – Thermal cycler
- – Dedicated pipettors (1-2 µl, 1-10 µl, 1-20 µl, 20-200 µl, 200-1000 µl)
- – PCR pipette tips suitable for use with the above pipettors and preferably equipped with hydrophobic filters
- – DNA size markers
- – 5X Stop/loading buffer
- – PCR reaction tubes
- – Mineral oil [Optional]: We recommend Bio Basic Inc. Cat. No. DBJ328
