This website uses cookies to ensure you get the best experience on our website.
- Table of Contents
Facts about Cell division cycle 5-like protein.
Component of the PRP19-CDC5L complex that forms an integral part of the spliceosome and is required for activating pre-mRNA splicing. The PRP19-CDC5L complex may also play a role in the response to DNA damage (DDR).
Human | |
---|---|
Gene Name: | CDC5L |
Uniprot: | Q99459 |
Entrez: | 988 |
Belongs to: |
---|
CEF1 family |
CDC5 (cell division cycle 5, S. pombe, homolog)-like; CDC5 cell division cycle 5-like (S. pombe); CDC5; Cdc5-like protein; Cdc5-related protein; CEF1; cell division cycle 5-like protein; dJ319D22.1 (CDC5-like protein); dJ319D22.1; hCDC5; KIAA0432; PCDC5RPCDC5-LIKE; Pombe cdc5-related protein
Mass (kDA):
92.251 kDA
Human | |
---|---|
Location: | 6p21.1 |
Sequence: | 6; NC_000006.12 (44387706..44450425) |
Ubiquitously expressed in both fetal and adult tissues.
Nucleus. Nucleus speckle. Cytoplasm. May shuttle between cytoplasm and nucleus.
Boster Bio's Anti-CDC5L Marker is a great option for scientists. This product offers several benefits, including its specificity. Continue reading to learn more about the products, and their applications. Boster Bio also offers product credits to scientists worldwide. These benefits include free samples, the possibility of submitting results for applications and special sample submissions. You can also submit and receive product credits.
Anti-CDC5L in Bostern bio is an antibody that reacts to Human and Rat. The product is non-hazardous. It is formulated in 10mM PBST with 0.05% BSA/zide. A blocking peptide is available separately, which varies in length and can be used to block the immunogen. This antibody has been tested on Immunofluorescence (WB), and IHC assays.
Boster Biologicals produces antibodies that are high affinity. Boster Biologicals antibodies are well-respected and trusted by the research community. They have been tested for sensitivity to ensure that they are of the highest quality. Boster also provides immunological reagents, such as Anti-CDC5L Marker, through tebu-bio. With their products, researchers can perform experiments with the highest level of precision, sensitivity, and selectivity.
Multifunctional transcription factor, CDC5L, plays multiple roles in early chondrogenesis. It inhibits pre-mRNA splicing, promotes early chondrocyte differentiation, and regulates WEE1 expression. CDC5L binds directly on pre-mRNAs. CDC5L also inhibits expression of WEE1 by human chondrocytes. It also increases expression of COL2A1 as well as SOX9.
CDC5L promotes transcriptional activation for the hTERT enhancer. It has potential oncogenic activity in a variety of tumours, including cervical and osteosarcoma. It is closely linked to the mitotic stage in the cell cycle, making it an attractive target for tumor therapy. However, the role of CDC5L in bladder cancer is still not well understood. For now, its clinical utility is limited.
CDC5L is a functional homolog to the cdc5 gene from Schizosaccharomyces pombe. It controls cell cycle progression and is part of nonsnRNA spliceosomes. Because it is a member of the spliceosome complex, CDC5L may have a role in gene transcription. In a previous study CDC5L knockdown cellular cells significantly reduced mesenchymal markers protein expression and increased epithelial marker Ecadherin protein expression.
CDC5L is expressed in high numbers in melanoma cells. In vitro, the protein CDC5L specifically binds the FAH gene. FAH expression, mRNA as well as protein, were decreased by the knockdown of CDC5L. The CDC5L protein is required for the expression of FAH in tumor cells. FAH expression will be reduced by knocking down CDC5L protein in human fibroblast cells.
The CDC5L marker, a DNA-binding proteins, plays a variety of roles in cell cycle regulation. It has been suggested that it acts as a transcription activator. The PRP19/CDC5L compound is part the spliceosome. Researchers can identify a particular protein by using the CDC5L marker when pulling down samples. The CDC5L complex consists four domains: one region and a motif.
The CDC5L marker was used for detecting hnRNP–M. It was specific for the central region of hnRNP–M (amino acids 248, 344). The CDC5L antibodies stained peri-chromatin fibrils in terbium citrate with the CDC5L antigen. The CDC5L antibody could also be used to detect mutants 1, 4 and 5.
CDC5L was found interacted with the NLS of CTNNBL1 or PLRG1. Deuterium exchange signatures in both proteins' NLS regions suggested that the interaction occurred. CWC15 also has a binding spot for CTNNBL1, suggesting that CTNNBL1 may pull down CDC5L frags. Although this association cannot be definitively demonstrated, the CDC5L marker is known to be specific to hnRNP-M.
The CDC5L genes can be used to diagnose multiple conditions. They are expressed in all cell types. It is not understood what its primary role is in splicing human mRNA. There are many factors that influence the choice of the correct splicing site. This regulatory role has been demonstrated to be played by the CDC5L genes. In vivo, CDC5L interacts with ten to twenty percent tagged hnRNP–M. Furthermore, a CDC5L gene product has been implicated in early splicing.
The CDC5L genetic variant is a potential oncogene that regulates cell cycle G2/M progress. This gene is overexpressed and causes aberrant cell cycle control, which can lead to osteosarcoma. We identified genes that are controlled by CDC5L, and identified inhibitors to this protein's function. These inhibitors may be useful for arresting osteosarcoma cell proliferation.
CDC5L regulates the cell cycle and plays a crucial role in chondrocyte differentiation. It regulates pre-mRNA and mRNA splicing, and promotes proliferation of chondrocytes. It also regulates SOX9 expression and COL2A1 transcription. While it is not known what CDC5L does exactly, it is important we note that the gene is often linked with chondrocyte development.
Knockdown of CDC5L impairs proliferative capacity in HeLa and U2OS cell lines. This gene expression pattern suggests that there is a molecular cause for the proliferative defect. CDC5L is also linked to many important pathways including hypoxia signaling as well as cancer. It could therefore be a therapeutic target to stop HCC progression. There are many genes that are associated with CDC5L. These genes can help you determine if the gene is necessary for cancer progression or development.
The CDC5L gene is a functional homolog of the Schizosaccharomyces pombe cdc5 gene. CDC5L is a fundamental component of non-snRNA spliceosome. It shares DNA sequencing homology with the transcription element c-Myb. CDC5L, in addition to its role within the cell cycle, is also a transcription factor that may regulate gene expression. Its binding spot is located on chr15 at 80430676 and 80430688. CDC5L has a TTTATTATTATTATGTATTCTATGTATTATTC, which is highly similar to CCND3.
The cost of the CDC5L markers is approximately $85 each test. It is usually shipped within one to three working days. It is a non-invasive test which detects the presence CDC5L within tumour cells. The test results are provided in a standardized format. CDC5L is expressed in a high frequency in cancer cells. Multiple clinical and pathological signs can be seen in tumor cells expressing CDC5L.
Researchers have discovered that higher levels CDC5L are associated to lower overall survival. The statistical difference was significant. The CDC5L marker may be contributing to bladder cancer progression by inhibiting apoptosis. Cost of the CDC5L mark depends on the size of the tumor cells. The test's results are well worth the expense.
PMID: 9038199 by Bernstein H.S., et al. Pombe Cdc5-related protein. A putative human transcription factor implicated in mitogen-activated signaling.
PMID: 9598309 by Groenen P.M.A., et al. Rearrangement of the human CDC5L gene by a t(6;19)(p21;q13.1) in a patient with multicystic renal dysplasia.