This website uses cookies to ensure you get the best experience on our website.
- Table of Contents
2 Citations 5 Q&As
4 Citations 11 Q&As
Facts about Collagen alpha-1(XVIII) chain.
Mouse | |
---|---|
Gene Name: | Col18a1 |
Uniprot: | P39061 |
Entrez: | 12822 |
Belongs to: |
---|
multiplexin collagen family |
antiangiogenic agent; COL18A1; collagen alpha-1(XVIII) chain; collagen, type XVIII, alpha 1; Endostatin; FLJ27325; FLJ34914; human type XVIII collagen10endostatin; KNO; KNO1MGC74745; Knobloch syndrome, type 1; KS; multi-functional protein MFP
Mass (kDA):
182.172 kDA
Mouse | |
---|---|
Location: | 10 C1|10 39.72 cM |
Sequence: | 10; |
Expressed in liver, kidney, lung, skeletal muscle and testis.
This article will discuss Boster Bio's Anti-Collagen alpha-1 (XVIII) chain COL18A1 Marker. This high-affinity primary antibody is specifically designed to detect the COL18A1 protein. This antibody is available to researchers across the globe. Boster Bio's COL18A1 Marker is also available in many different formats that include protein expression.
Many companies offer the anti-Collagen Alpha-1 (XVIII) chain COL18A1 marker. The antibody targets the protein and gene responsible for the production of collagen type XVIII. Endostatin, KNO and KS may also be called the chain of XVIII. The collagen is composed of 178 kilodaltons. Based on the name of the gene it is possible that there are both porcine and canine orthologs.
Western Blotting can identify this protein. The antibody is a heparin sulfate glycosaminoglycan side chain. It is extensively expressed at the basement membranes of the epithelial and vascular. This antibody recognizes COL18A1 through Western Blotting. It is recommended to use it for the determination of this collagen type in a variety tissues.
The antibody is developed to detect the presence of collagen type XVIII alpha-1 (XVIII) chain in human plaques. It is extremely sensitive and specific, detecting bands at a low level in protein that is intact. It can also detect lower-molecular-we1 Mt bands that are a result of increased proteolysis. This antibody is available in a range of sizes to meet your specific testing needs.
High-affinity primary antibodies were developed with the COL180A1 marker. This marker is extremely expressed in the neural retina. Our antibodies target the GFAP proteins in the inner limit region. In situ hybridization was employed to confirm this. Images of Col18a1/ and wild-type mice aged 18 months old were used to create the images. Both cases contained antibodies that detected GFAP within the limiting membrane of the innermost layer.
Several antibodies were used in this study. BTX was purchased from Molecular Probes/Invitrogen Eugene, OR. The anti-DIG antibodies were diluted with a-bungarotoxin , 1:10,000.
The expression of the Purkinje cell in col18a1 was measured from the same sections used as positive controls. DAB reactions were carried out on 40 um vibratome section sections. Horseradish peroxidase-labeled secondary antibodies were detected using 3,3'-diaminobenzidine tetrahydrochloride hydrate. Images were captured using an Olympus microscope BX51 equipped with CCD cameras in color.
The COL18A1 gene is found in human ovaries and other tissues. COL18A1 expression is dependent upon the COL18A1 gene. This marker is present in men as well as women. The COL18A1 gene is present in a variety of tissues of the body including the retina. This marker was identified in a study of 3 unrelated patients suffering from Knobloch syndrome. The older sibling was diagnosed with an occipital meningocele as well as retinal detach and neuronal movement disorder. The patients suffered from mild developmental and learning disabilities.
Another intriguing aspect of COL18A1 is the presence of markers that are placed on mucin surfaces. B cells that are specific for sugar recognize clustered Tn, or sialyl-Tn, on mucin surfaces. This marker allows the identification of target proteins. This marker is particularly useful for finding mucins in tumors. The study also uncovers the possibility of binding of mucin to galectin-1.
The antigen derived from COL18A1 can identify many different antigens. It can also identify human cells that have the COL18A1 protein. This marker permits researchers to make high-affinity antibodies by using this marker. For this, it must be tagged with an epitope of collagen. There are several different polyclonal antibodies expressing COL18A1 in mice that are useful for clinical research.
The COL18A1 gene includes instructions for making collagen XVIII. Collagen XVIII is composed of three proteins called alpha 1 subunits. They are found in basement membranes which are thin tissue sheets that support and separate cells. The presence of the COL18A1 marker can help determine if patients suffer from collagen XVIII deficiency. Here's a brief description of the protein.
The COL18A1 gene is a part of the NFKL/ASKM genetic group. It is a potential cause for CML/MDS, and has recently been linked to breast cancer as well as ovarian cancer. Researchers have also discovered a feedback mechanism. For instance, the increased expression of the gene's SNPs could be a sign that the gene is crucial for the development of cancer.
The COL18A1 gene is the gene with an extra copy made available by the third chromosome 21. Unlike the normal population, individuals with COL18A1 are very unlikely to develop solid tumors. Endostatin, a gene, prevents tumor growth. A study published in Nature Genetics in 2008 uncovered an inherited mutation in the COL18A1 gene that alters the function of the protein.
A single nucleotide primer extension was used to create a mutant version COL18A1 using the SNuPE method. The primers for exons three and 42 were ctggatgagatgatgatgatgatgatgatgatgatgatgagatgatgatgatgatgatgatggagatgatgatgatgatgatgatgatgabgatgatgatgatgatgatgatgatgat
COL18A1 is a potential gene for adipogenesis. Recent studies have shown that COL18A1 has receptors for glypican. These studies suggest that this gene may be a key factor in the etiology of PACG. It is possible that the COL18A1 genes are responsible for the burden of the disease in large numbers of patients with PAC or PACS. However, it is possible that the COL18A1 gene contributes to the burden of disease through screening large numbers of PACG-affected individuals.
PMID: 8188673 by Rehn M.V., et al. Primary structure of the alpha 1 chain of mouse type XVIII collagen, partial structure of the corresponding gene, and comparison of the alpha 1(XVIII) chain with its homologue, the alpha 1(XV) collagen chain.
PMID: 8838808 by Rehn M., et al. Characterization of the mouse gene for the alpha-1 chain of type XVIII collagen (COL18A1) reveals that the three variant N-terminal polypeptide forms are transcribed from two widely separated promoters.
*More publications can be found for each product on its corresponding product page