GSTP1 Antibodies

Glutathione S-transferase P (GSTP1)

Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Regulates negatively CDK5 activity via p25/p35 translocation to prevent neurodegeneration.

.

Gene Information

Human
Gene Name:	GSTP1
Uniprot:	P09211
Entrez:	2950

Family

Belongs to:
GST superfamily

Alternative Names

deafness, X-linked 7; DFN7; EC 2.5.1.18; FAEES3; fatty acid ethyl ester synthase III; glutathione S-transferase P; Glutathione STransferase pi 1; Glutathione S-Transferase pi 1; GST class-pi; GST3DFN7; GSTP; GSTP1; GSTP1-1; PI

Molecular Weight

Mass (kDA):
23.356 kDA

Genomic Context

Human
Location:	11q13.2
Sequence:	11; NC_000011.10 (67583812..67586653)

Subcellular Localizations

Cytoplasm. Mitochondrion. Nucleus. The 83 N-terminal amino acids function as un uncleaved transit peptide, and arginine residues within it are crucial for mitochondrial localization.

Diseases

• Malignant Neoplasms
• Neoplasms
• Carcinoma
• Malignant Neoplasm Of Prostate
• Prostatic Neoplasms
• Carcinogenesis
• Malignant Neoplasm Of Breast
• Mammary Neoplasms
• Malignant Neoplasm Of Lung
• Adenocarcinoma
• Malignant Squamous Cell Neoplasm
• Lung Neoplasms
• Malignant Paraganglionic Neoplasm

• Colorectal Cancer
• Cell Transformation, Neoplastic
• Colorectal Neoplasms
• Liver Carcinoma
• Leukemia
• Hyperplasia
• Asthma

Interacting Proteins

• APPBP2
• KRT31
• KRTAP10-7
• KRTAP10-9
• NOTCH2NL

• PRDX6
• TRAF2

Pathways

• Methylation
• Dna Methylation
• Pathogenesis
• Dna Repair
• Conjugation
• Drug Resistance
• Cell Proliferation
• Excretion
• Cell Cycle
• Transport
• Dna Hypermethylation
• Gene Silencing
• Demethylation

• Cell Death
• Localization
• Cell Growth
• Aging
• Inflammatory Response
• Response To Oxidative Stress
• Cell Cycle Arrest

PTMs

• Methylation
• Phosphorylation
• Reduction
• Demethylation
• Acetylation
• Oxidation

• Cleavage
• Glutathionylation
• Deacetylation
• Nitrosylation
• Hydroxylation
• Dephosphorylation

• Ubiquitination

Research Areas

• Asthma
• Cancer
• Immunology
• Neuroscience

For details, visit:
bosterbio.com/bosterbio-gene-info-cards/GSTP1

Best Uses Of The GSTP1 Marker

The molecular-biology tool that makes use of GSTP1 as its GSTP1 marker to detect and study genetic variations in any protein has proven to be very popular. Although the GSTP1 gene is located in the heart, it's often mistakenly believed to be part the immune system. Boster Bio provides this marker for scientists from all over the world. Scientists can utilize this marker to determine specific samples or applications, and receive product credit.

Monoclonal Anti-GST3/GST pi/GSTP1 antibody

This Boster Bio Anti GST3/GSTp1 monoclonal antibody recognizes Human, Mouse, Rat and rat GST3 sequences. This product is suitable for Western Blot and Immunohistochemistry. It is designed to be specific and sensitive for E. coli recombinant proteins.

This antibody recognizes GST3/GST/pi as an human protein. It is used for Western blot and immunohistochemistry. It can also be used to identify Xenobiotics in cells and metabolites. However, it isn't advised for diagnostic or clinical applications. It is best used for research purposes.

Anti-Bax (Apoptosis Marker) monoclonal antibody

This anti-Bax (Apoptossis Marker) monoclonal antibodies from Boster Bio has been used to identify the Apoptosis marker Bax. It reacts with Human, Rat, and Mouse cells. It can also be used to detect cleaved cleaved caspase-9 or LC3.

BAX is a member of the Bcl-2 family of proteins, is frequently thought of as an anti-apoptotic proteins. However it actually has an active role in promoting the death of cells. BAX is controlled by heterodimerization and homo of various isoforms. BAX beta, for example, has a carboxyl terminus which does not have a hydrophobic transmembrane. The Bcl-2 family members play a major role in the growth of cells.

Anti-Bax mAbs were created by immunizing mice in BALB/c with the recombinant BHRF1 protein (49) as described by Tsai and co. 58. Assays for immunofluorescence, Western Blot analysis, and analysis of immunofluorescence revealed that 3E8 was the most active antibody clone.

PCR-RFLP technique to detect GSTP1 polymorphism

To check for GSTP1 mutation, DNA was extracted from blood samples by using QIAamp Blood Kit. The PCR-RFLP method produced the sequences of primers for GSTP1. They were amplified by a restriction length polymorphism (RFLP). The GSTP1 primer sequence is ACCCCAGGGCTCTTTGTGAA and TGAGGGCACAAGAAGCCT. DNA from the sample was used as a template for 25 ul solution, and Tag(r)Green Master Mix (2x) was added.

A study conducted in Iraq revealed an association between GSTP1 polymorphism and COPD risk. The PCR-RFLP method can identify variant versions of the gene that may be associated with asthma or atopic dermatitis. The related RFLP tests demonstrated high sensitivity and specificity, and were sufficiently sensitive to identify variant GSTP1 variants. GSTP1.

A PCR-RFLP technique was employed to determine a distinct genetic variation in GSTT1 and GSTM1 genes. The CYP1A1 sequence-specific amplification gene was also employed to identify GSTP1 as well as GSTM1 homozygotes that have no null alleles. Amplification of both genes in a single reaction yielded a PCR-RFLP pattern, which was used as an internal control.

This study utilized PCR-RFLP to identify GSTP1's mutation in a single sample. The PCR-RFLP method can be employed to detect GSTP1 polymorphisms across multiple DNA samples. It can identify multiple mutations in GSTT1 or GSTM1, which is associated with the risk of developing many cancers.

The PCR-RFLP method was employed to identify GSTP1 polymorphism using exon 5 variant primer pairs. Exon 5 variant primers start at 2721 bp. This is the GSTP1 region. The PCRs were carried out on an Astec PC-800 temperature control system. A total of 100 ng of genomic DNA was added to the PCR mix, which contained 11 pmol of each primer pair. A final volume of 15 ml was used for PCR.

The PCR-RFLP method was highly sensitive to detect the presence of a polymorphism in GSTP1 in 120 samples of urine and blood from patients with bladder cancer. It is interesting to note that the c.313A>G genotype did not correlate with bladder cancer in the Turkish population, however, the "TC" allele was associated with a greater risk of developing bladder cancer. These results suggest that the c.313A>G polymorphism in gene may be a useful tool for treating patients suffering from bladder cancer.

Asthma and GSTP1 polymorphism

It isn't known whether there is a connection between the GSTP1 polymorphism (and asthma). Although studies have linked various modifiable genes to asthma, there is no connection between the GSTP1 polymorphism and asthma. In this review, we will discuss the evidence for the connection between GSTP1 polymorphism and asthma. We also propose an alternative explanation for the association between the GSTP1 Polymorphism as well as asthma.

In a prior study, the GSTP1 genotypes were also associated with asthma. The GSTP1 AA genotype was associated with a greater chance of developing asthma than the GSTP1BB genotype. However, the connections between GSTP1 AB/AB genotypes and asthma were not statistically significant. In addition, there were no significant associations between GSTP1 genotype AB/AB as well as the asthma phenotype AD.

Genetic studies have shown that GSTP1 genotypes are associated with asthma, atopy and atopy. These studies suggest that the genetic connection between GSTP1 genotypes, asthma, and atopy may be intra- and interethnic. However, more research is needed to determine whether GSTP1 genotypes affect the intrauterine environment. To confirm this connection, future genetic studies are required to investigate the genetic relationship between asthma and GSTP1 genotypes.

Although the connection between the GSTP1 genotype and asthma isn't fully understood The authors have established that the GSTP1 Val105/Val105 genotype can have a protective effect on lung function in patients with AHR. The findings were based upon a small sample of study. The authors suggest that future studies will confirm the findings in larger samples. Furthermore, more research is needed to determine if any other factors are responsible for the correlation.

Asthma is a multifactorial condition with an apparent genetic predisposition and immunological aberration. The GST genes could be linked with asthma as a result of allelic variations. These polymorphisms may be able to increase asthma risk and have been linked to other environmental diseases. It is not known which genes may influence the susceptibility to asthma. For the sake of clarity, these studies should include independent genetic association studies.