Click image to see more details
Product Info Summary
| SKU: | M00040-3 |
|---|---|
| Size: | 100ul |
| Reactive Species: | Human, Mouse, Rat |
| Host: | Mouse |
| Application: | ELISA, IF, WB |
Customers Who Bought This Also Bought
Product info
Product Name
Anti-Bcl-2 Monoclonal Antibody
SKU/Catalog Number
M00040-3
Size
100ul
Form
Liquid
Description
Boster Bio Anti-Bcl-2 Monoclonal Antibody catalog # M00040-3. Tested in IHC, WB applications. This antibody reacts with Human, Mouse, Rat.
Storage & Handling
Store at -20°C for one year. For short term storage and frequent use, store at 4°C for up to one month. Avoid repeated freeze-thaw cycles.
Cite This Product
Anti-Bcl-2 Monoclonal Antibody (Boster Biological Technology, Pleasanton CA, USA, Catalog # M00040-3)
Host
Mouse
Contents
Liquid in PBS containing 50% glycerol, 0.5% stabilizing protein and 0.02% sodium azide.
This antibody is supplied in a stabilized formulation.
Compatibility with conjugation reactions depends on the chemistry of the conjugation method used.
For conjugation methods that are not compatible with the stabilizing components present in this formulation, a carrier-free antibody format is required.
Clonality
Monoclonal
Clone Number
6B5
Isotype
IgG
Immunogen
Synthetic Peptide of human Bcl-2 AA range: 1-100
Reactive Species
M00040-3 is reactive to BCL2 in Human, Mouse, Rat
Calculated molecular weight
26.3 kDa
Antibody Validation
Boster validates all antibodies on WB, IHC, ICC, Immunofluorescence, and ELISA with known positive control and negative samples to ensure specificity and high affinity, including thorough antibody incubations.
Application & Images
Applications
M00040-3 is guaranteed for ELISA, IF, WB Boster Guarantee
Assay Dilutions Recommendation
The recommendations below provide a starting point for assay optimization. The actual working concentration varies and should be decided by the user.
WB 1:500-2000
IF 1:100-500
ELISA 1:1000-5000
Validation Images & Assay Conditions
Click image to see more details
Western blot analysis of lysates from 1)Hela cell , 2)Hela cells knockdown by siRNA1 (F:GGAUGACUGAGUACCUGAATT, R:UUCAGGUACUCAGUCAUCCTT) siRNA2 (F:GUGAUGAAGUACAUCCAUUAU, R:AUAAUGGAUGUACUUCAUCAC), (Green) primary antibody was diluted at 1:1000, 4°over night, Dylight 800 secondary antibody was diluted at 1:10000, 37° 1hour. (Red) GAPDH rabbit antibody was diluted at 1:5000 as loading control, 4° over night, Dylight 680 secondary antibody was diluted at 1:10000, 37° 1hour.
Click image to see more details
Various whole cell lysates were separated by 10% SDS-PAGE, and the membrane was blotted with anti-BCL-2 antibody. The HRP-conjugated Goat anti-Mouse IgG (H + L) antibody was used to detect the antibody. Lane 1: THP-1 Lane 2: MOLT-4 Lane 3: Raji Lane 4: HL-60 Lane 5: K562 Lane 6: Daudi Lane 7: Raw264.7 Lane 8: Mouse spleen Lane 9: Rat thymus
Specific Publications For Anti-Bcl-2 Monoclonal Antibody (M00040-3)
Loading publications
Recommended Resources
Here are featured tools and databases that you might find useful.
- Boster's Pathways Library
- Protein Databases
- Bioscience Research Protocol Resources
- Data Processing & Analysis Software
- Photo Editing Software
- Scientific Literature Resources
- Research Paper Management Tools
- Molecular Biology Software
- Primer Design Tools
- Bioinformatics Tools
- Phylogenetic Tree Analysis
Customer Reviews
Have you used Anti-Bcl-2 Monoclonal Antibody?
Share your experimental results or join a short interview to earn up to $1,000 in product credits or other rewards.
0 Reviews For Anti-Bcl-2 Monoclonal Antibody
Customer Q&As
Have a question?
Find answers in Q&As, reviews.
Can't find your answer?
Submit your question
